Yum, spotting regulations...

regul@tion spotting

documentation

known variant

disease causing

Model: extragenic, score: 38.8813928989465 (classification due to ClinVar)      
Summary
  • known HGMD disease mutation at this position
  • known disease mutation: rs587776528 (pathogenic)
hyperlink
analysed issue analysis result
name of alteration no title
alteration (phys. location) chr1:160001799G>C   IGV
alteration type single base exchange
alteration region extragenic
known variant Variant was neither found in ExAC nor 1000G.

known disease mutation: rs587776528 (pathogenic for Glycosylphosphatidylinositol deficiency) dbSNP  NCBI variation viewer
known disease mutation at this position (HGMD ID CR063411)
Ensembl multicell regulatory features
PromoterENSR000000804461:160000061-160002862
Ensembl detailed regulatory features
other regulatory regions
DHSDNase1 hypersensitive site in promoter1:160000927-160002299
H3K4me3H3K4me3 in 3 cell lines, overlap with promoter1:160000060-160002982
promoter by TSS500bp upstream / 50bp downstreamPIGM1:160001733-160002283
TFBSGabp1:160001568-160002109
regulatory features from VISTA and FANTOM5 FANTOM TSS strict; Class: Transcription Start Site; location: chr1:160001797-160001805
tarbase miRNA binding site(s) no miRNA binding sites annotated
interactions with distant genomic regions no interactions annotated
phyloP / phastCons
PhyloPPhastCons
(flanking)-0.3920.081
2.0390.902
(flanking)2.0390.98
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
chromosome 1
strand 1
chromosomal position
(for ins/del: last normal base / first normal base)
160001799
original chrDNA sequence snippet CCGCTTCTTCTTCCAGCGGAGGCGGGATTTCCGGTCCGTGG
altered chrDNA sequence snippet CCGCTTCTTCTTCCAGCGGACGCGGGATTTCCGGTCCGTGG
speed 2.61 s

All positions are in basepairs (bp) if not explicitely stated differently.
aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project

mod_perl version: CGI