Yum, spotting regulations...

regul@tion spotting

documentation

Likely effect

likely functional

Model: extragenic, score: 35.0497698010144      
name of alteration no title
alteration (phys. location) chr1:27113734T>C   IGV
alteration type single base exchange
alteration region extragenic
known variant Reference ID: rs574885709
Allele 'C' was neither found in ExAC nor 1000G.
Ensembl multicell regulatory features
PromoterENSR000015806121:27113512-27116113
Ensembl detailed regulatory features
other regulatory regions
DHSDNase1 hypersensitive site in promoter1:27112484-27116077
H3K4me3H3K4me3 in 3 cell lines, overlap with promoter1:27112895-27115976
promoter by TSS500bp upstream / 50bp downstreamPIGV1:27113463-27114013
regulatory features from VISTA and FANTOM5 no external features annotated
tarbase miRNA binding site(s) no miRNA binding sites annotated
interactions with distant genomic regions
affected geneelementHUVECHeLaNHEKtranscripts
PIGV (ENSG00000060642)promoter XXXprotein-coding: ENST00000430292
ARID1A (ENSG00000117713)overlaps with promoter XXXnonsense_mediated_decay: ENST00000532781
PIGV (ENSG00000060642)overlaps with promoter XXXprotein-coding: ENST00000078527, ENST00000374145, ENST00000431541, ENST00000449950, ENST00000455364 nonsense_mediated_decay: ENST00000472757
show interactions as plot
show details
phyloP / phastCons
PhyloPPhastCons
(flanking)0.3770.949
1.1540.962
(flanking)2.0960.962
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
chromosome 1
strand 1
chromosomal position
(for ins/del: last normal base / first normal base)
27113734
original chrDNA sequence snippet AAACTGGCCGCTCCCCCCAATAGACGGTTTTGTTGAGTTCG
altered chrDNA sequence snippet AAACTGGCCGCTCCCCCCAACAGACGGTTTTGTTGAGTTCG
speed 1.21 s

All positions are in basepairs (bp) if not explicitely stated differently.
aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project

mod_perl version: CGI