show me some regulation...

RegulationSpotter results



RegulationSpotter documentation


chrpositionrefaltresultvariant frequencymost severe result Xscore type intragenic variant NMD / PTC / frameshift / truncated amino acid substitution(s) within protein domains altered splicing Kozak sequence altered polyA signal changed miRNA binding site FANTOM5 / VISTA multicell regulatory feature within promoter H3K4me3 positive DNase1 hypersensitive site within TFBS genomic interaction(s) PhyloP (max) phastCons (max) CADD (scaled) variant frequency  
1160001799GC
disease causing (ClinVar)
allele unknown / extremely rare
  38 SNV                                  
FANTOM5 / VISTA   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -0.392 / 2.039 / 2.039   phastCons (up/max/down): 0.081 / 0.902 / 0.98   CADD (scaled): 12.19   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results
1737844280GC
disease causing
likely regulatory variant
allele unknown / extremely rare
  38 SNV                                  
within PGAP3, ERBB2  model: 1   probability: 1  
FANTOM5 / VISTA   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): 3.269 / 0.422 / 3.269   phastCons (up/max/down): 0.926 / 0.928 / 0.932, 0 / 0 / 0   CADD (scaled): 19.92   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results intragenic results
1737844339GA
disease causing
likely regulatory variant
allele unknown / extremely rare
  40 SNV                                  
within PGAP3, ERBB2  model: 1   probability: 1  
FANTOM5 / VISTA   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): 1.347 / 2.779 / 2.346   phastCons (up/max/down): 1 / 1 / 0.977, 0 / 0 / 0   CADD (scaled): 22   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results intragenic results
113818877CG
disease causing
likely regulatory variant
allele unknown / extremely rare
  24 SNV                                  
within NUP98  model: 1   probability: 1  
multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   PhyloP (up/max/down): 0.804 / 2.783 / -0.11   phastCons (up/max/down): 0 / 0 / 0, 0.022 / 0.029 / 0.003   CADD (scaled): 10.93   ExAC/1000G: homozygous (0/0), carriers (0/3)  
extragenic results intragenic results
2197697789GA
disease causing
likely regulatory variant
allele unknown / extremely rare
  16 SNV                                  
within PGAP1  model: 1   probability: 1  
PhyloP (up/max/down): 1.557 / 0.022 / 2.813   phastCons (up/max/down): 1 / 0.995 / 1, 0 / 0 / 0   CADD (scaled): 10.11   ExAC/1000G: homozygous (0/0), carriers (0/2)  
extragenic results intragenic results
113846356GAG
disease causing
likely regulatory variant
allele unknown / extremely rare
  26 short InDel                                  
within PGAP2  model: 1, 2   within protein domains   amino acid substitution(s): G211-, G264-, G55-, G272-, G268-, G51-   within protein domains   probability: 1  
multicell regulatory feature   within TFBS   PhyloP (up/max/down): 5.054 / 3.265 / 5.054   phastCons (up/max/down): 0 / 0 / 0, 1 / 1 / 1   CADD (scaled): 26.3   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results intragenic results
1716216927AC
disease causing
likely regulatory variant
allele unknown / extremely rare
  26 SNV                                  
within PIGL  model: 1   altered splicing   probability: 1  
multicell regulatory feature   DNase1 hypersensitive site   PhyloP (up/max/down): 1.001 / 2.675 / 3.182   phastCons (up/max/down): 0.931 / 0.997 / 1, 0 / 0 / 0   CADD (scaled): 27.2   ExAC/1000G: homozygous (0/0), carriers (4/2)  
extragenic results intragenic results
1716229133GA
disease causing
likely regulatory variant
allele unknown / extremely rare
  15 SNV                                  
within PIGL  model: 1, 2   within protein domains   amino acid substitution(s): R227H   within protein domains   probability: 0.999999, 1, 0.940163  
PhyloP (up/max/down): 1.008 / -0.006 / 0.036   phastCons (up/max/down): 0.978 / 0.905 / 0.909, 0 / 0 / 0   CADD (scaled): 28.7   ExAC/1000G: homozygous (0/0), carriers (12/0)  
extragenic results intragenic results
1859824990TA
disease causing
likely regulatory variant
allele unknown / extremely rare
  19 SNV                                  
within PIGN  model: 1   probability: 1  
within promoter   PhyloP (up/max/down): 5.085 / -0.623 / 6.158   phastCons (up/max/down): 0 / 0 / 0, 1 / 0.833 / 1   CADD (scaled): 6.12   ExAC/1000G: homozygous (0/0), carriers (1/0)  
extragenic results intragenic results
1734894124GA
disease causing
likely regulatory variant
allele unknown / extremely rare
  18 SNV                                  
within PIGW  model: 2   amino acid substitution(s): D392N   probability: 0.998877  
PhyloP (up/max/down): 1.453 / 2.934 / 3.12   phastCons (up/max/down): 0 / 0 / 0, 1 / 1 / 1   CADD (scaled): 26.1   ExAC/1000G: homozygous (0/0), carriers (1/0)  
extragenic results intragenic results
1716120482CT
likely regulatory variant
allele unknown / extremely rare
  36 SNV                                  
multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): 1.474 / 1.45 / 1.489   phastCons (up/max/down): 0.997 / 1 / 1   CADD (scaled): 12.5   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results
127113734TC
likely regulatory variant
allele unknown / extremely rare
  35 SNV                                  
might interact with: ARID1A (-12373 bp from TSS), PIGV (229 bp from TSS)   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   PhyloP (up/max/down): 0.377 / 1.154 / 2.096   phastCons (up/max/down): 0.949 / 0.962 / 0.962   CADD (scaled): 12.8   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results
127113730CG
likely regulatory variant
allele unknown / extremely rare
  34 SNV                                  
might interact with: PIGV (233 bp from TSS), ARID1A (-12369 bp from TSS)   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   PhyloP (up/max/down): 0.313 / 0.78 / -0.626   phastCons (up/max/down): 0.975 / 0.961 / 0.897   CADD (scaled): 11.74   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results
4492929AC
likely regulatory variant
polymorphism
allele unknown / extremely rare
  28 SNV                                  
within ZNF721  model: 1   probability: 0.999683  
FANTOM5 / VISTA   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -1.605 / -0.289 / -1.43   phastCons (up/max/down): 0.001 / 0 / 0, 0 / 0 / 0   CADD (scaled): 3.18   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results intragenic results
4492932TC
likely regulatory variant
polymorphism
allele unknown / extremely rare
  28 SNV                                  
within ZNF721  model: 1   probability: 0.999869  
FANTOM5 / VISTA   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): 0.532 / -0.342 / 0.63   phastCons (up/max/down): 0 / 0 / 0, 0.002 / 0.003 / 0.004   CADD (scaled): 8.23   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results intragenic results
4493013GA
likely regulatory variant
polymorphism
allele unknown / extremely rare
  28 SNV                                  
within PIGG  model: 1   probability: 0.999927  
FANTOM5 / VISTA   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -0.189 / -0.396 / -0.589   phastCons (up/max/down): 0 / 0 / 0   CADD (scaled): 8.78   ExAC/1000G: homozygous (0/0), carriers (0/2)  
extragenic results intragenic results
1716120539TC
likely regulatory variant
polymorphism
allele unknown / extremely rare
  28 SNV                                  
within PIGL  model: 1   probability: 0.999909  
FANTOM5 / VISTA   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -2.229 / -0.114 / -0.215   phastCons (up/max/down): 0 / 0.002 / 0.029, 0 / 0 / 0   CADD (scaled): 6.81   ExAC/1000G: homozygous (0/0), carriers (1/1)  
extragenic results intragenic results
1737844354AT
likely regulatory variant
polymorphism
allele unknown / extremely rare
  27 SNV                                  
within PGAP3, ERBB2  model: 1   probability: 0.999897  
FANTOM5 / VISTA   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -0.78 / -2.329 / -1.203   phastCons (up/max/down): 0 / 0 / 0   CADD (scaled): 8.44   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results intragenic results
2044044690CT
likely regulatory variant
allele unknown / extremely rare
  26 SNV                                  
multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): 0.457 / 0.487 / 0.078   phastCons (up/max/down): 0 / 0.001 / 0   CADD (scaled): 10.25   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results
1716120499GA
likely regulatory variant
allele unknown / extremely rare
  25 SNV                                  
multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -0.642 / -0.033 / 0.081   phastCons (up/max/down): 0 / 0 / 0   CADD (scaled): 5.74   ExAC/1000G: homozygous (0/0), carriers (3/0)  
extragenic results
2044044667GA
likely regulatory variant
allele unknown / extremely rare
  25 SNV                                  
multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -0.053 / -0.86 / 0.788   phastCons (up/max/down): 0 / 0 / 0.001   CADD (scaled): 7.53   ExAC/1000G: homozygous (0/0), carriers (0/4)  
extragenic results
2044044707AG
likely regulatory variant
allele unknown / extremely rare
  25 SNV                                  
multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -0.497 / -0.474 / 0.095   phastCons (up/max/down): 0 / 0.001 / 0.114   CADD (scaled): 6.84   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results
127113771C
likely regulatory variant
allele unknown / extremely rare
  24 short InDel                                  
might interact with: PIGV (192 bp from TSS), ARID1A (-12410 bp from TSS)   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   PhyloP (up/max/down): 0.324 / 0.134 / -0.333   phastCons (up/max/down): 0.004 / 0.002 / 0   CADD (scaled): 4.36   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results
489445406CT
likely regulatory variant
allele unknown / extremely rare
  24 SNV                                  
might interact with: PYURF (442 bp from TSS), PKD2 (distant from TSS), PIGY (2466 bp from TSS), LOC100129137 (2905 bp from TSS), LOC101929134 (-399 bp from TSS)   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   PhyloP (up/max/down): -0.074 / -0.295 / -1.387   phastCons (up/max/down): 0 / 0 / 0   CADD (scaled): 3.28   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results
113818870GA
likely regulatory variant
polymorphism
allele unknown / extremely rare
  23 SNV                                  
within NUP98  model: 1   probability: 0.999404  
multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   PhyloP (up/max/down): 0.063 / 0.811 / -0.559   phastCons (up/max/down): 0 / 0 / 0, 0.008 / 0.006 / 0   CADD (scaled): 5.26   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results intragenic results
113818954GA
likely regulatory variant
polymorphism
allele unknown / extremely rare
  22 SNV                                  
within NUP98  model: 1   probability: 0.867043  
FANTOM5 / VISTA   multicell regulatory feature   DNase1 hypersensitive site   within promoter   PhyloP (up/max/down): -0.091 / -0.933 / 2.743   phastCons (up/max/down): 0 / 0 / 0.015, 0 / 0 / 0   CADD (scaled): 2.62   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results intragenic results
1734893357CG
likely regulatory variant
polymorphism
allele unknown / extremely rare
  17 SNV                                  
within PIGW  model: 2   within protein domains   amino acid substitution(s): T136S   within protein domains   probability: 0.998882  
PhyloP (up/max/down): 1.994 / 0.958 / 1.661   phastCons (up/max/down): 0.998 / 1 / 1, 0 / 0 / 0   CADD (scaled): 6.1   ExAC/1000G: homozygous (0/0), carriers (1/0)  
extragenic results intragenic results
2315349848TC
likely regulatory variant
allele unknown / extremely rare
  16 SNV                                  
PhyloP (up/max/down): 2.955 / 0.224 / 0.291   phastCons (up/max/down): 1 / 0.992 / 0.993   CADD (scaled): 22.8   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results
2315350040CT
likely regulatory variant
allele unknown / extremely rare
  16 SNV                                  
might interact with: ACE2 (distant from TSS), PIGA (-74 bp from TSS), FIGF (-15557 bp from TSS)   PhyloP (up/max/down): 1.575 / 0.077 / 0.927   phastCons (up/max/down): 0.844 / 0.741 / 0.742   CADD (scaled): 24.2   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results
2315337796TA
likely regulatory variant
allele unknown / extremely rare
  15 SNV                                  
PhyloP (up/max/down): 1.241 / 2.493 / 0.068   phastCons (up/max/down): 0.781 / 0.781 / 0.666   CADD (scaled): 12.01   ExAC/1000G: homozygous (0/0), carriers (0/2)  
extragenic results
489442045TG
likely regulatory variant
allele unknown / extremely rare
  15 SNV                                  
might interact with: PIGY (-895 bp from TSS), PKD2 (distant from TSS), LOC101929134 (154 bp from TSS), PYURF (-2919 bp from TSS), LOC100129137 (6266 bp from TSS)   within promoter   PhyloP (up/max/down): -0.258 / 2.511 / 0.122   phastCons (up/max/down): 0 / 0.006 / 0.002   CADD (scaled): 8.61   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results
489442139TG
likely regulatory variant
polymorphism
allele unknown / extremely rare
  13 SNV                                  
within ENST00000273968  model: 1   probability: 1  
might interact with: PYURF (-2825 bp from TSS), LOC100129137 (6172 bp from TSS), PKD2 (distant from TSS), LOC101929134 (60 bp from TSS), PIGY (-801 bp from TSS)   within promoter   PhyloP (up/max/down): 0.092 / -0.757 / -3.409   phastCons (up/max/down): 0 / 0 / 0   CADD (scaled): 7.02   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results intragenic results
1859828572AT
likely regulatory variant
polymorphism
allele unknown / extremely rare
  9 SNV                                  
within PIGN  model: 2   within protein domains   amino acid substitution(s): F5L   within protein domains   probability: 0.902369  
PhyloP (up/max/down): -0.003 / -0.115 / 1.917   phastCons (up/max/down): 0.253 / 0.252 / 0.915, 0 / 0 / 0   CADD (scaled): 3.3   ExAC/1000G: homozygous (0/0), carriers (0/0)  
extragenic results intragenic results
1859711463AG
possible regulatory variant
polymorphism
allele unknown / extremely rare
  6 SNV                                  
within PIGN  model: 1   probability: 1  
PhyloP (up/max/down): 0.776 / -0.036 / -0.678   phastCons (up/max/down): 0.083 / 0.015 / 0.001, 0 / 0 / 0   CADD (scaled): 3.72   ExAC/1000G: homozygous (0/0), carriers (0/1)  
extragenic results intragenic results
1734891029
TTGTGCGAGTGCGGCGGAGTG
polymorphism (automatic)
homozygosity rare
  26 InDel >10                                  
within PIGW  model: 1   probability: 0.999622  
multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -0.374 / 0.653 / -0.302   phastCons (up/max/down): 0.007 / 0.074 / 0, 0 / 0 / 0   CADD (scaled): 9.03   ExAC/1000G: homozygous (0/21), carriers (0/313)  
extragenic results intragenic results
2044044520TAT
polymorphism (automatic)
homozygosity rare
  26 short InDel                                  
multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   within promoter   within TFBS   PhyloP (up/max/down): -0.334 / 1.745 / -0.385   phastCons (up/max/down): 0 / 0.003 / 0   CADD (scaled): 8.25   ExAC/1000G: homozygous (0/13), carriers (0/232)  
extragenic results
489444271G
polymorphism (automatic)
homozygosity very common
  19 short InDel                                  
within ENST00000273968  model: 1   probability: 0.999995  
might interact with: PYURF (-693 bp from TSS), LOC101929134 (690 bp from TSS), PKD2 (distant from TSS), PIGY (1331 bp from TSS), LOC100129137 (4040 bp from TSS)   multicell regulatory feature   H3K4me3 positive   DNase1 hypersensitive site   PhyloP (up/max/down): -0.477 / -0.514 / -1.329   phastCons (up/max/down): 0 / 0 / 0, 0.001 / 0.001 / 0.001   CADD (scaled): 5.74   ExAC/1000G: homozygous (0/574), carriers (0/1686)  
extragenic results intragenic results
2197789834TCT
polymorphism (automatic)
homozygosity rare
  15 short InDel                                  
within PGAP1  model: 1   probability: 0.999973  
multicell regulatory feature   H3K4me3 positive   PhyloP (up/max/down): 2.133 / 0.316 / 0.095   phastCons (up/max/down): 0 / 0 / 0, 0.013 / 0.003 / 0   CADD (scaled): 9.65   ExAC/1000G: homozygous (0/37), carriers (0/553)  
extragenic results intragenic results
113819866T
polymorphism (automatic)
homozygosity very common
  14 short InDel                                  
within PGAP2  model: 1   probability: 0.999998  
multicell regulatory feature   H3K4me3 positive   PhyloP (up/max/down): -1.018 / -1.664 / -1.28   phastCons (up/max/down): 0 / 0 / 0, 0.002 / 0.001 / 0.003   CADD (scaled): 0.22   ExAC/1000G: homozygous (0/1907), carriers (0/2478)  
extragenic results intragenic results
1716121168T
polymorphism (automatic)
homozygosity very rare
  14 short InDel                                  
within PIGL  model: 1   probability: 0.999998  
multicell regulatory feature   H3K4me3 positive   PhyloP (up/max/down): 0.084 / 0 / -0.667   phastCons (up/max/down): 0 / 0 / 0   ExAC/1000G: homozygous (0/6), carriers (0/85)  
extragenic results intragenic results
1859732154A
polymorphism (automatic)
homozygosity very common
  9 short InDel                                  
within PIGN  model: 1   probability: 0.999999  
PhyloP (up/max/down): -0.251 / 0.487 / 0.467   phastCons (up/max/down): 0 / 0 / 0, 0.165 / 0.197 / 0.216   CADD (scaled): 7.75   ExAC/1000G: homozygous (0/988), carriers (0/2075)  
extragenic results intragenic results
4495692CT
polymorphism (automatic)
homozygosity very rare
  6 short InDel                                  
within PIGG  model: 1   probability: 1  
PhyloP (up/max/down): 0.148 / 0.072 / -0.88   phastCons (up/max/down): 0 / 0 / 0, 0.001 / 0.001 / 0.001   CADD (scaled): 6.2   ExAC/1000G: homozygous (0/6), carriers (0/178)  
extragenic results intragenic results
2315337850A
polymorphism (automatic)
homozygosity common
  6 short InDel                                  
PhyloP (up/max/down): -0.033 / 0 / -1.728   phastCons (up/max/down): 0 / 0 / 0   ExAC/1000G: homozygous (0/448), carriers (0/1004)  
extragenic results